ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA' phred33 -trimlog fastq/trimlog.txt fastq/Test_adapter_contamination.fq.gz fastq/Test_adapter_ ILLUMINACLIP:trimmomatic/adapters/TruSeq3-SE.fa:2:30:7 MINLEN:15 You should see the following message: TrimmomaticSE: Started with arguments: ILLUMINACLIP:trimmomatic/adapters/TruSeq3-SE.fa:2:30:7 \ The command we need use is: java -jar trimmomatic/trimmomatic-0.39.jar \įastq/Test_adapter_ \ MINLEN: where : Specifies the minimum length of reads to be kept reads that have been trimmed to less that this length will be discarded.ĭetails of all the parameters can be found in the documentation on the Trimmomatic website. simpleClipThreshold: specifies how accurate the match between any adapter etc.palindromeClipThreshold: specifies how accurate the match between the two ‘adapter ligated’ reads must be for PE palindrome read alignment.seedMismatches: specifies the maximum mismatch count which will still allow a full match to be performed.The naming of the various sequences within this file determines how they are used. : specifies the path to a fasta file containing all the adapters, PCR sequences etc. There are various trimming steps that Trimmomatic will apply. Here we have single end data, so we will use the fasta Trimmomatic-0.39/adapters/TruSeq3-SE.fa. For common Illumina adapters, these are provided in the Trimmomatic directory under adapters. To trim the adapter we need to provide Trimmomatic with a fasta file containing the adapters we want to remove.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |